Our second #DNADay post of the day is "Where we are in the T2T Genomes Era, Pt 1".

An expert Q&A covering benchmarking and featuring insight from Heng Li, Guojie Zhang and Jue Ruan
http://gigasciencejournal.com/blog/dna-day-2025-t2t-genomes-pt-1/

DNA Day 2025: Where we are in the T2T Genomes Era, Pt 1 - GigaBlog

Nicely timed for #DNAday we have the first benchmarking data for the new CycloneSEQ platform:

Efficiently Constructing Complete Genomes with CycloneSEQ to Fill Gaps in Bacterial Draft Assemblies. GigaByte. 2025. https://doi.org/10.46471/gigabyte.154

More in GigaBlog
http://gigasciencejournal.com/blog/open-cycloneseq-benchmarking-for-complete-bacterial-genomes/

On #DNAday (today) it is always a bit discouraging to see DNA still displayed in the wrong (left-handed) chirality, like in the example attached. After all these years... see also users.fred.net/tds//leftdna/

RE: https://bsky.app/profile/did:plc:i36fojyhnaovpmieuoudj2zu/post/3lnmxz5dqgs2n
Bluesky

Bluesky Social

Our first big news of #DNADay 2025🧬 is mission accomplished for #BauhiniaGenome
.

After nearly a decade, our emblematic, crowdfunded community genome project for #HongKong has solved the historical mystery of HK Bauhinia’s origins with a complete gapless T2T genome reference

http://gigasciencejournal.com/blog/mission-accomplished-for-bauhinia-genome/

Read the Research here, which also part of our T2T Series:

The haplotype-resolved T2T genome for Bauhinia Γ— blakeana sheds light on the genetic basis of flower heterosis
https://doi.org/10.1093/gigascience/giaf044

DNA Day 2025: Mission Accomplished for Bauhinia Genome - GigaBlog

Es ist #DNADay! Um die Entdeckung der DNA-Struktur vor 70 Jahren zu feiern, schnappt euch ein paar Legosteine - Kinderzimmer dΓΌrfen geplΓΌndert werden- und baut ein DNA-Modell mit uns! #LegoDNA

#QuestionOfTheWeek: What are your DNA ethnicity estimates? Any surprises? Share your percentages & discoveries! Compare with relatives to break through brick walls.
https://www.youtube.com/watch?v=nwimjqnLbPw&list=PLEqK4ICkQWXQXODTRG6UGGZ4cmXiMRmD4

#DNADay
#CollaborativeGenealogy #AncestryDNA #23andMe #MyHeritage #FamilyTreeDNA #GEDMatch

#QuestionOfTheWeek What are your DNA ethnicity estimates?

YouTube

Happy #DNADay!

Even E.T. had DNA if I remember the movie correctly.

https://dnaday.org/dna-day-faq/#1639452594289-5aaac3ca-16ed

DNA Day: Frequently Asked Questions - DNA Day

These frequentley asked questions explain more about DNA Day.

DNA Day

#DNAday

catgcgccgccgtatgataacgcggatgcgtat

🧬 Happy #DNADay! 🧬

This could be a great time to have a look at our programme and sign up for one of our upcoming symposia on the topic:
πŸ”Ή'Reconstructing the human past: using ancient and modern genomics' ➑️ s.embl.org/ees24-09
πŸ”Ή'The complex life of RNA' ➑️ s.embl.org/ees24-11
πŸ”Ή'DNA replication: from basic biology to disease' ➑️ s.embl.org/ees24-12

Submit your abstract now and we hope to see you this autumn πŸ™ŒπŸ»

#NationalDNADay #WorldDNADay #Genomics4All #DNADay24

DNA day 2024

DNA day is celebrated on April 25, 2024. DNA Day commemorates the day in 1953 when James Watson, Francis Crick, Maurice Wilkins, Rosalind Franklin and ...

Cute Calendar