Our second #DNADay post of the day is "Where we are in the T2T Genomes Era, Pt 1".
An expert Q&A covering benchmarking and featuring insight from Heng Li, Guojie Zhang and Jue Ruan
http://gigasciencejournal.com/blog/dna-day-2025-t2t-genomes-pt-1/
Our second #DNADay post of the day is "Where we are in the T2T Genomes Era, Pt 1".
An expert Q&A covering benchmarking and featuring insight from Heng Li, Guojie Zhang and Jue Ruan
http://gigasciencejournal.com/blog/dna-day-2025-t2t-genomes-pt-1/
Nicely timed for #DNAday we have the first benchmarking data for the new CycloneSEQ platform:
Efficiently Constructing Complete Genomes with CycloneSEQ to Fill Gaps in Bacterial Draft Assemblies. GigaByte. 2025. https://doi.org/10.46471/gigabyte.154
More in GigaBlog
http://gigasciencejournal.com/blog/open-cycloneseq-benchmarking-for-complete-bacterial-genomes/
Our first big news of #DNADay 2025🧬 is mission accomplished for #BauhiniaGenome
.
After nearly a decade, our emblematic, crowdfunded community genome project for #HongKong has solved the historical mystery of HK Bauhinia’s origins with a complete gapless T2T genome reference
http://gigasciencejournal.com/blog/mission-accomplished-for-bauhinia-genome/
Read the Research here, which also part of our T2T Series:
The haplotype-resolved T2T genome for Bauhinia × blakeana sheds light on the genetic basis of flower heterosis
https://doi.org/10.1093/gigascience/giaf044
#QuestionOfTheWeek: What are your DNA ethnicity estimates? Any surprises? Share your percentages & discoveries! Compare with relatives to break through brick walls.
https://www.youtube.com/watch?v=nwimjqnLbPw&list=PLEqK4ICkQWXQXODTRG6UGGZ4cmXiMRmD4
#DNADay
#CollaborativeGenealogy #AncestryDNA #23andMe #MyHeritage #FamilyTreeDNA #GEDMatch
Happy #DNADay!
Even E.T. had DNA if I remember the movie correctly.
catgcgccgccgtatgataacgcggatgcgtat
🧬 Happy #DNADay! 🧬
This could be a great time to have a look at our programme and sign up for one of our upcoming symposia on the topic:
🔹'Reconstructing the human past: using ancient and modern genomics' ➡️ s.embl.org/ees24-09
🔹'The complex life of RNA' ➡️ s.embl.org/ees24-11
🔹'DNA replication: from basic biology to disease' ➡️ s.embl.org/ees24-12
Submit your abstract now and we hope to see you this autumn 🙌🏻