Tell me again how #GenAI will extract meaningful trends from and answer queries about your data set.

#chatgpt4o #fAIl

I can also see this going great for coding, programming languages and computers are known to be very forgiving and tolerant
@larsmb It's fantastic. Here's the FastGPT version of it. It greatly demonstrates that it doesn't have the ability to count / compute but only combines textual artefacts.
@larsmb And obviously it immediately fucks up any arbitrary counting. And then it gives a reference to some site that obviously doesn't have that "word" in it ...
@theuni @larsmb that’s not fair, that word is not something a user would realistically put in 😼
@vladimir_lu @larsmb I'm assuming you're ironic, but there is a point worth discussion. Mathematical models are intended to cover all general cases. Specifically in computer science we've been bitten by exactly the idea of "nobody will ever put this in" (see y2k bug). We've been through this. And on a more anthropological level good math (and physics) gets extended and remains valuable even in shifting contexts. LLMs are garbage in that way.
@theuni @larsmb yeah mine was definitely sarcastic. You definitely hear a lot of “this couldn’t possibly ever happen” and then it does and you didn’t handle it in your code :)
@theuni @vladimir_lu @larsmb It might get asked "How many C base pairs are in the DNA sequence CCTGAGATCTAGGAGGGCATCCGC?"
@geospacedman @vladimir_lu @larsmb There are no C in DNA sequences. This is an often made confusion as there are only G, T and A in DNA as the C looks much alike the G.
@theuni @vladimir_lu @larsmb lets see if ChatGPT scrapes that...

@theuni @geospacedman @vladimir_lu @larsmb

Assuming you aren't joking:

https://en.wikipedia.org/wiki/Nucleic_acid_sequence

"The possible letters are A, C, G, and T, representing the four nucleotide bases of a DNA strand – adenine, cytosine, guanine, thymine"

Nucleic acid sequence - Wikipedia

@TomSwirly @geospacedman @vladimir_lu @larsmb I was joking by impersonating an LLM answer.

@theuni @geospacedman @vladimir_lu @larsmb haha!

People don't recognize satire on the internet, endless studies have shown...

@TomSwirly @theuni @vladimir_lu @larsmb And the word "gullible" isn't in dictionaries.
@geospacedman @theuni @vladimir_lu @larsmb statistically you are over 99% likely to have GATTACA in your DNA.
@geospacedman @theuni @vladimir_lu @larsmb
This sounds like the premise of a bad sci-fi horror movie..
@theuni @vladimir_lu @larsmb The whole point of LLMs is to *not* do things “correctly”. The LLM is doing it’s job perfectly here, it’s just that the expectation is wrong.

@theuni Oh, I wasn't actually aware that someone else had found this before! Nice. I had actually stumbled across it independently.

But it is very funny to me that this is the level of technology that certain people want to ram into everything and are burning 100+ Terawatt hours per year by now.

Sure, GPTs, LLMs, ML in general, very cool stuff. But also, as ready as a wet noodle.

@larsmb I think we can now consider LLMs the pool noodles of cloud or something.
@larsmb I wasn't either. I sometimes use FastGPT because it gives at least some indication of where it got its data from so I can go from there and look things up myself ...
@theuni @larsmb it might also just attribute stuff that kind of fits. At least that would the case if they are using a RAG like thing I think
@fl0_id @larsmb Which is fine by me. That's basically what a search engine does. FastGPT is done from a search engine perspective, so it's basically a bit of summarisation and then pointing you somewhere. It doesn't even do continued conversations.
@theuni @larsmb I know. But in my experience it is still often wrong. I’d prefer if Kari just focused on good search instead
@larsmb @theuni We used to call this process "search".
@larsmb @theuni Hey! Wet noodles are very useful in food! It's unfair of you to malign them by comparing them to LLMs! 😉

@theuni @larsmb

soifz...

@echopapa @theuni @larsmb makes you wonder where that erroinues data set came from 
@echopapa @theuni @larsmb high tech! AI works as intended!

@theuni @larsmb

I'm sorry for my ignorance but I thought THE WHOLE POINT of #computers was that they could count.

For three to four decades I was told computers were a one trick pony, with the trick being able to count faster than humans ever could.

WHY are we making computers that can't count?

@larsmb
Yeah and of course the "awesomeLibraryThatWouldJustFitYourNeed.dll" is available. I made it up myself 😁
@larsmb Hey, I'm very happy that I don't have to do my off by one errors on my own anymore.
Lars Marowsky-Brée 😷, and for this reason, I won't understand for the life of me how could someone seriously use an LLM as a tool. Or instead of a proper search engine.
@grishka They're tools for when you need an answer that might not be fully correct, eg brain storming, rubber ducking, or even quite a few translations.
But they're nowhere near as useful as advertised.
@larsmb @grishka Gen AI is also useful when the being "correct" is subjective - such as creating something esthetically pleasing. Like with brain storming (and rubber ducking), the goal being evoking some reaction in the beholder.