Tell me again how #GenAI will extract meaningful trends from and answer queries about your data set.

#chatgpt4o #fAIl

I can also see this going great for coding, programming languages and computers are known to be very forgiving and tolerant
@larsmb It's fantastic. Here's the FastGPT version of it. It greatly demonstrates that it doesn't have the ability to count / compute but only combines textual artefacts.
@larsmb And obviously it immediately fucks up any arbitrary counting. And then it gives a reference to some site that obviously doesn't have that "word" in it ...
@theuni @larsmb that’s not fair, that word is not something a user would realistically put in 😼
@vladimir_lu @larsmb I'm assuming you're ironic, but there is a point worth discussion. Mathematical models are intended to cover all general cases. Specifically in computer science we've been bitten by exactly the idea of "nobody will ever put this in" (see y2k bug). We've been through this. And on a more anthropological level good math (and physics) gets extended and remains valuable even in shifting contexts. LLMs are garbage in that way.
@theuni @vladimir_lu @larsmb It might get asked "How many C base pairs are in the DNA sequence CCTGAGATCTAGGAGGGCATCCGC?"
@geospacedman @theuni @vladimir_lu @larsmb
This sounds like the premise of a bad sci-fi horror movie..